Region

Applications

Separation of 39 and 40mer DNA Mix

Application Detail (App ID: 16065)

Part No:00B-4441-E0
Dimensions:50 x 4.6 mm ID
Elution Type:Gradient
Elution A:50 mm TEAA, pH 7.5
Elution B:Methanol
Gradient Profile:
Step No. Time (min) Pct A Pct B
1 0 75 25
2 30 65 35

Flow Rate:1 mL/min
Col. Temp: ambient
Detection: UV-Vis Abs.-Variable Wave.(UV) @ 260 nm (22°C)
Note:SecurityGuard™ Guard Cartridge System extends column lifetime.
- SecurityGuard Cartridges, Clarity Oligo-RP 4 x 3.0mm, 10/Pk Part No.: AJ0-8135
- Holder Part No.: KJ0-4282

Analyte Details

Analyte Detail not available

1
CTTCTGAACAGTTGATCTATGCACTTCAGACTTATGATCA

2
TTCTGAACAGTTGATCTATGCACTTCAGACTTATGATCA